Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   A7A1_RS18635 Genome accession   NC_019896
Coordinates   3610712..3610834 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis str. BSP1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 3605712..3615834
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  A7A1_RS18605 (A7A1_3096) yclP 3605784..3606542 (-) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -
  A7A1_RS18610 (A7A1_3097) yclO 3606536..3607483 (-) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  A7A1_RS18615 (A7A1_3098) yclN 3607476..3608427 (-) 952 Protein_3655 petrobactin ABC transporter permease YclN -
  A7A1_RS18620 (A7A1_3099) thrD 3608811..3610175 (+) 1365 WP_015252822.1 aspartate kinase -
  A7A1_RS18625 yczN 3610328..3610441 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  A7A1_RS21325 yczM 3610523..3610612 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  A7A1_RS18635 (A7A1_3100) phrC 3610712..3610834 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  A7A1_RS18640 (A7A1_3101) rapC 3610818..3611966 (-) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  A7A1_RS18645 (A7A1_3102) yclK 3612130..3613551 (-) 1422 WP_015252824.1 two-component system sensor histidine kinase YclK -
  A7A1_RS18650 yclJ 3613538..3614221 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=45473 A7A1_RS18635 WP_003224994.1 3610712..3610834(-) (phrC) [Bacillus subtilis subsp. subtilis str. BSP1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=45473 A7A1_RS18635 WP_003224994.1 3610712..3610834(-) (phrC) [Bacillus subtilis subsp. subtilis str. BSP1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment