Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   BSNT_RS02180 Genome accession   NC_017196
Coordinates   426540..426662 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. natto BEST195     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 421540..431662
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BSNT_RS02165 (BSNT_00666) yclJ 423154..423837 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BSNT_RS02170 (BSNT_00667) yclK 423824..425245 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  BSNT_RS02175 (BSNT_00668) rapC 425408..426556 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BSNT_RS02180 (BSNT_06716) phrC 426540..426662 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BSNT_RS22115 (BSNT_06717) yczM 426761..426850 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BSNT_RS02190 (BSNT_06718) yczN 426932..427045 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  BSNT_RS02195 (BSNT_00672) thrD 427198..428562 (-) 1365 WP_014478832.1 aspartate kinase -
  BSNT_RS02200 (BSNT_00674) ceuB 428953..429903 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BSNT_RS02205 (BSNT_00675) yclO 429896..430843 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BSNT_RS02210 (BSNT_00676) yclP 430837..431595 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=45462 BSNT_RS02180 WP_003224994.1 426540..426662(+) (phrC) [Bacillus subtilis subsp. natto BEST195]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=45462 BSNT_RS02180 WP_003224994.1 426540..426662(+) (phrC) [Bacillus subtilis subsp. natto BEST195]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment