Detailed information    

insolico Bioinformatically predicted

Overview

Name   comA/nlmT   Type   Regulator
Locus tag   ST4052_RS07910 Genome accession   NZ_CP065476
Coordinates   1531265..1531420 (-) Length   51 a.a.
NCBI ID   WP_309252056.1    Uniprot ID   -
Organism   Streptococcus thermophilus strain 4052     
Function   transport of ComC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1526265..1536420
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ST4052_RS07870 (ST4052_07950) nusB 1526714..1527148 (-) 435 WP_002951890.1 transcription antitermination factor NusB -
  ST4052_RS07875 (ST4052_07955) - 1527141..1527530 (-) 390 WP_002951891.1 Asp23/Gls24 family envelope stress response protein -
  ST4052_RS07880 (ST4052_07960) efp 1527601..1528161 (-) 561 WP_011227545.1 elongation factor P -
  ST4052_RS07885 (ST4052_07965) - 1528274..1528729 (-) 456 WP_002951893.1 deaminase -
  ST4052_RS07890 (ST4052_07970) - 1528748..1529809 (-) 1062 WP_011227546.1 Xaa-Pro peptidase family protein -
  ST4052_RS07895 (ST4052_07975) - 1529998..1530426 (-) 429 WP_002946567.1 hypothetical protein -
  ST4052_RS07900 (ST4052_07980) - 1530653..1531063 (-) 411 WP_232086121.1 hypothetical protein -
  ST4052_RS07905 - 1531032..1531238 (-) 207 WP_250637332.1 ATP-binding cassette domain-containing protein -
  ST4052_RS07910 comA/nlmT 1531265..1531420 (-) 156 WP_309252056.1 ATP-binding cassette domain-containing protein Regulator
  ST4052_RS07915 (ST4052_07990) - 1531608..1531799 (-) 192 WP_002946571.1 hypothetical protein -
  ST4052_RS07920 (ST4052_07995) - 1531961..1532233 (-) 273 WP_002946573.1 DUF3923 family protein -
  ST4052_RS07925 (ST4052_08000) uvrA 1532327..1535152 (-) 2826 WP_011227549.1 excinuclease ABC subunit UvrA Machinery gene
  ST4052_RS07930 (ST4052_08005) - 1535461..1536405 (+) 945 WP_011227550.1 magnesium transporter CorA family protein -

Sequence

Protein


Download         Length: 51 a.a.        Molecular weight: 5307.25 Da        Isoelectric Point: 10.6194

>NTDB_id=447311 ST4052_RS07910 WP_309252056.1 1531265..1531420(-) (comA/nlmT) [Streptococcus thermophilus strain 4052]
MDNISLTLKKGNIAGLIGNNGAGKTTLMKLISGILERPNGTIDLNTKTVVP

Nucleotide


Download         Length: 156 bp        

>NTDB_id=447311 ST4052_RS07910 WP_309252056.1 1531265..1531420(-) (comA/nlmT) [Streptococcus thermophilus strain 4052]
TTGGATAATATCTCTCTAACCTTGAAAAAGGGGAATATTGCTGGTCTGATTGGCAATAATGGTGCAGGAAAGACGACCTT
AATGAAATTAATTTCGGGTATCTTAGAGAGACCTAATGGAACTATTGACTTAAATACTAAAACTGTGGTGCCTTGA

Domains

Predicted by InterProScan.

ABC transporter (ABC_tran)

(2-48)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comA/nlmT Streptococcus mutans UA159

42.222

88.235

0.373