Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   IRJ27_RS07780 Genome accession   NZ_CP064095
Coordinates   1529296..1529418 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain N1303-2Ay     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 1524296..1534418
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  IRJ27_RS07750 yclP 1524367..1525125 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  IRJ27_RS07755 yclO 1525119..1526066 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  IRJ27_RS07760 ceuB 1526059..1527009 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  IRJ27_RS07765 thrD 1527394..1528758 (+) 1365 WP_003234493.1 aspartate kinase -
  IRJ27_RS07770 yczN 1528912..1529025 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  IRJ27_RS07775 yczM 1529107..1529196 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  IRJ27_RS07780 phrC 1529296..1529418 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  IRJ27_RS07785 rapC 1529402..1530550 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  IRJ27_RS07790 yclK 1530713..1532134 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  IRJ27_RS07795 yclJ 1532121..1532804 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=442041 IRJ27_RS07780 WP_003224994.1 1529296..1529418(-) (phrC) [Bacillus subtilis strain N1303-2Ay]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=442041 IRJ27_RS07780 WP_003224994.1 1529296..1529418(-) (phrC) [Bacillus subtilis strain N1303-2Ay]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1