Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   IRJ24_RS03295 Genome accession   NZ_CP064093
Coordinates   624187..624309 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain N1282-4at     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 619187..629309
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  IRJ24_RS03265 yclP 619258..620016 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  IRJ24_RS03270 yclO 620010..620957 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  IRJ24_RS03275 ceuB 620950..621900 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  IRJ24_RS03280 thrD 622285..623649 (+) 1365 WP_003234493.1 aspartate kinase -
  IRJ24_RS03285 yczN 623803..623916 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  IRJ24_RS03290 yczM 623998..624087 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  IRJ24_RS03295 phrC 624187..624309 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  IRJ24_RS03300 rapC 624293..625441 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  IRJ24_RS03305 yclK 625604..627025 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  IRJ24_RS03310 yclJ 627012..627695 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=441681 IRJ24_RS03295 WP_003224994.1 624187..624309(-) (phrC) [Bacillus subtilis strain N1282-4at]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=441681 IRJ24_RS03295 WP_003224994.1 624187..624309(-) (phrC) [Bacillus subtilis strain N1282-4at]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1