Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   HC659_RS02150 Genome accession   NZ_CP051465
Coordinates   429393..429515 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain UCMB5121     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424393..434515
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HC659_RS02135 (HC659_04210) yclJ 426007..426690 (+) 684 WP_032722955.1 two-component system response regulator YclJ -
  HC659_RS02140 (HC659_04220) yclK 426677..428098 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  HC659_RS02145 (HC659_04230) rapC 428261..429409 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  HC659_RS02150 (HC659_04240) phrC 429393..429515 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  HC659_RS02155 yczM 429615..429704 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  HC659_RS02160 yczN 429786..429899 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  HC659_RS02165 (HC659_04250) thrD 430052..431416 (-) 1365 WP_015715246.1 aspartate kinase -
  HC659_RS02170 (HC659_04260) ceuB 431801..432751 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  HC659_RS02175 (HC659_04270) yclO 432744..433691 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  HC659_RS02180 (HC659_04280) yclP 433685..434443 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=438535 HC659_RS02150 WP_003224994.1 429393..429515(+) (phrC) [Bacillus subtilis subsp. subtilis strain UCMB5121]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=438535 HC659_RS02150 WP_003224994.1 429393..429515(+) (phrC) [Bacillus subtilis subsp. subtilis strain UCMB5121]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1