Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   IMY14_RS02125 Genome accession   NZ_CP063150
Coordinates   420450..420572 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain s-16     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 415450..425572
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  IMY14_RS02110 yclJ 417063..417746 (+) 684 WP_063336130.1 two-component system response regulator YclJ -
  IMY14_RS02115 yclK 417733..419154 (+) 1422 WP_080467384.1 two-component system sensor histidine kinase YclK -
  IMY14_RS02120 rapC 419318..420466 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  IMY14_RS02125 phrC 420450..420572 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  IMY14_RS02130 yczM 420672..420761 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  IMY14_RS02135 yczN 420843..420956 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  IMY14_RS02140 thrD 421109..422473 (-) 1365 WP_063336058.1 aspartate kinase -
  IMY14_RS02145 ceuB 422858..423808 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  IMY14_RS02150 yclO 423801..424748 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  IMY14_RS02155 yclP 424742..425500 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=437046 IMY14_RS02125 WP_003224994.1 420450..420572(+) (phrC) [Bacillus subtilis strain s-16]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=437046 IMY14_RS02125 WP_003224994.1 420450..420572(+) (phrC) [Bacillus subtilis strain s-16]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1