Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   IHV08_RS02140 Genome accession   NZ_CP062497
Coordinates   421810..421932 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain CV16     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416810..426932
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  IHV08_RS02125 (IHV08_02125) yclJ 418424..419107 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  IHV08_RS02130 (IHV08_02130) yclK 419094..420515 (+) 1422 WP_192858199.1 two-component system sensor histidine kinase YclK -
  IHV08_RS02135 (IHV08_02135) rapC 420678..421826 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  IHV08_RS02140 (IHV08_02140) phrC 421810..421932 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  IHV08_RS02145 (IHV08_02145) yczM 422032..422121 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  IHV08_RS02150 (IHV08_02150) yczN 422203..422316 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  IHV08_RS02155 (IHV08_02155) thrD 422470..423834 (-) 1365 WP_128992406.1 aspartate kinase -
  IHV08_RS02160 (IHV08_02160) ceuB 424219..425169 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  IHV08_RS02165 (IHV08_02165) yclO 425162..426109 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  IHV08_RS02170 (IHV08_02170) yclP 426103..426861 (+) 759 WP_192858200.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=431379 IHV08_RS02140 WP_003224994.1 421810..421932(+) (phrC) [Bacillus subtilis strain CV16]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=431379 IHV08_RS02140 WP_003224994.1 421810..421932(+) (phrC) [Bacillus subtilis strain CV16]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1