Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   GII77_RS02210 Genome accession   NZ_CP045825
Coordinates   434752..434874 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain 75     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 429752..439874
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GII77_RS02195 (GII77_02195) yclJ 431365..432048 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  GII77_RS02200 (GII77_02200) yclK 432035..433456 (+) 1422 WP_015252824.1 two-component system sensor histidine kinase YclK -
  GII77_RS02205 (GII77_02205) rapC 433620..434768 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  GII77_RS02210 (GII77_02210) phrC 434752..434874 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GII77_RS02215 (GII77_02215) yczM 434974..435063 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  GII77_RS02220 (GII77_02220) yczN 435145..435258 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  GII77_RS02225 (GII77_02225) thrD 435411..436775 (-) 1365 WP_015252822.1 aspartate kinase -
  GII77_RS02230 (GII77_02230) ceuB 437159..438109 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  GII77_RS02235 (GII77_02235) yclO 438102..439049 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  GII77_RS02240 (GII77_02240) yclP 439043..439801 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=398273 GII77_RS02210 WP_003224994.1 434752..434874(+) (phrC) [Bacillus subtilis strain 75]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=398273 GII77_RS02210 WP_003224994.1 434752..434874(+) (phrC) [Bacillus subtilis strain 75]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment