Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   GII79_RS02155 Genome accession   NZ_CP045823
Coordinates   428198..428320 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain MB8_B1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423198..433320
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GII79_RS02140 (GII79_02140) yclJ 424812..425495 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  GII79_RS02145 (GII79_02145) yclK 425482..426903 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  GII79_RS02150 (GII79_02150) rapC 427066..428214 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  GII79_RS02155 (GII79_02155) phrC 428198..428320 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GII79_RS02160 (GII79_02160) yczM 428420..428509 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  GII79_RS02165 (GII79_02165) yczN 428591..428704 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  GII79_RS02170 (GII79_02170) thrD 428857..430221 (-) 1365 WP_029726569.1 aspartate kinase -
  GII79_RS02175 (GII79_02175) ceuB 430606..431556 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  GII79_RS02180 (GII79_02180) yclO 431549..432496 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  GII79_RS02185 (GII79_02185) yclP 432490..433248 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=398115 GII79_RS02155 WP_003224994.1 428198..428320(+) (phrC) [Bacillus subtilis strain MB8_B1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=398115 GII79_RS02155 WP_003224994.1 428198..428320(+) (phrC) [Bacillus subtilis strain MB8_B1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment