Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   BSN5_RS13745 Genome accession   NC_014976
Coordinates   2644417..2644539 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis BSn5     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 2639417..2649539
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BSN5_RS13730 (BSn5_13475) yclJ 2641031..2641714 (+) 684 WP_015715244.1 two-component system response regulator YclJ -
  BSN5_RS13735 (BSn5_13480) yclK 2641701..2643122 (+) 1422 WP_074794501.1 two-component system sensor histidine kinase YclK -
  BSN5_RS13740 (BSn5_13485) rapC 2643285..2644433 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BSN5_RS13745 (BSn5_13490) phrC 2644417..2644539 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BSN5_RS21615 yczM 2644639..2644728 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BSN5_RS13755 (BSn5_13495) yczN 2644810..2644923 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  BSN5_RS13760 (BSn5_13500) thrD 2645076..2646440 (-) 1365 WP_015715246.1 aspartate kinase -
  BSN5_RS13765 (BSn5_13505) ceuB 2646825..2647775 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BSN5_RS13770 (BSn5_13510) yclO 2647768..2648715 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BSN5_RS13775 (BSn5_13515) yclP 2648709..2649467 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=39785 BSN5_RS13745 WP_003224994.1 2644417..2644539(+) (phrC) [Bacillus subtilis BSn5]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=39785 BSN5_RS13745 WP_003224994.1 2644417..2644539(+) (phrC) [Bacillus subtilis BSn5]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment