Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   BSUW23_RS02120 Genome accession   NC_014479
Coordinates   416889..417011 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus spizizenii str. W23     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 411889..422011
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BSUW23_RS02105 (BSUW23_01935) yclJ 413504..414187 (+) 684 WP_003224983.1 two-component system response regulator YclJ -
  BSUW23_RS02110 (BSUW23_01940) yclK 414174..415595 (+) 1422 WP_079996289.1 two-component system sensor histidine kinase YclK -
  BSUW23_RS02115 (BSUW23_01945) rapC 415757..416905 (+) 1149 WP_003224987.1 response regulator aspartate phosphatase RapC Regulator
  BSUW23_RS02120 (BSUW23_01950) phrC 416889..417011 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BSUW23_RS02125 (BSUW23_01955) - 417110..417217 (-) 108 WP_003224996.1 YjcZ family sporulation protein -
  BSUW23_RS02130 (BSUW23_01960) - 417366..418730 (-) 1365 WP_003224998.1 aspartate kinase -
  BSUW23_RS02135 (BSUW23_01965) ceuB 419115..420065 (+) 951 WP_003225000.1 petrobactin ABC transporter permease YclN Machinery gene
  BSUW23_RS02140 (BSUW23_01970) yclO 420058..421005 (+) 948 WP_003225003.1 petrobactin ABC transporter permease YclO -
  BSUW23_RS02145 (BSUW23_01975) yclP 420999..421757 (+) 759 WP_013307916.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=38163 BSUW23_RS02120 WP_003224994.1 416889..417011(+) (phrC) [Bacillus spizizenii str. W23]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=38163 BSUW23_RS02120 WP_003224994.1 416889..417011(+) (phrC) [Bacillus spizizenii str. W23]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAACGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment