Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   G4G26_RS02155 Genome accession   NZ_CP049924
Coordinates   432773..432895 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain So1b     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 427773..437895
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  G4G26_RS02140 (G4G26_02150) yclJ 429387..430070 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  G4G26_RS02145 (G4G26_02155) yclK 430057..431478 (+) 1422 WP_182932208.1 two-component system sensor histidine kinase YclK -
  G4G26_RS02150 (G4G26_02160) rapC 431641..432789 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  G4G26_RS02155 (G4G26_02165) phrC 432773..432895 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  G4G26_RS02160 (G4G26_02170) yczM 432995..433084 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  G4G26_RS02165 (G4G26_02175) yczN 433166..433279 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  G4G26_RS02170 (G4G26_02180) thrD 433433..434797 (-) 1365 WP_163260128.1 aspartate kinase -
  G4G26_RS02175 (G4G26_02185) ceuB 435182..436132 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  G4G26_RS02180 (G4G26_02190) yclO 436125..437072 (+) 948 WP_131227116.1 petrobactin ABC transporter permease YclO -
  G4G26_RS02185 (G4G26_02195) yclP 437066..437824 (+) 759 WP_046664285.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=375586 G4G26_RS02155 WP_003224994.1 432773..432895(+) (phrC) [Bacillus subtilis strain So1b]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=375586 G4G26_RS02155 WP_003224994.1 432773..432895(+) (phrC) [Bacillus subtilis strain So1b]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment