Detailed information
Bioinformatically predicted
Overview
| Name | abrB | Type | Regulator |
| Locus tag | FHE73_RS13275 | Genome accession | NZ_CP040782 |
| Coordinates | 2559757..2560035 (+) | Length | 92 a.a. |
| NCBI ID | WP_089149651.1 | Uniprot ID | A0A9X6RQW9 |
| Organism | Bacillus thuringiensis strain HM-311 | ||
| Function | repression of comK; repression of rok (predicted from homology) Competence regulation |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Prophage | 2551477..2596489 | 2559757..2560035 | within | 0 |
Gene organization within MGE regions
Location: 2551477..2596489
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| FHE73_RS13225 (FHE73_13225) | - | 2551477..2551740 (+) | 264 | WP_002082716.1 | DUF3937 domain-containing protein | - |
| FHE73_RS13230 (FHE73_13230) | - | 2552089..2552223 (+) | 135 | Protein_2515 | site-specific integrase | - |
| FHE73_RS13235 (FHE73_13235) | - | 2552431..2552916 (+) | 486 | WP_002164034.1 | hypothetical protein | - |
| FHE73_RS13240 (FHE73_13240) | - | 2553226..2553927 (+) | 702 | WP_046946260.1 | DUF3962 domain-containing protein | - |
| FHE73_RS13245 (FHE73_13245) | - | 2553966..2555075 (-) | 1110 | WP_089149655.1 | tyrosine-type recombinase/integrase | - |
| FHE73_RS13250 (FHE73_13250) | - | 2555681..2556889 (+) | 1209 | WP_089149654.1 | AimR family lysis-lysogeny pheromone receptor | - |
| FHE73_RS31175 | - | 2556916..2557071 (+) | 156 | WP_175423348.1 | hypothetical protein | - |
| FHE73_RS13255 (FHE73_13255) | - | 2557335..2557685 (-) | 351 | WP_000367267.1 | helix-turn-helix transcriptional regulator | - |
| FHE73_RS13260 (FHE73_13260) | - | 2557872..2558096 (+) | 225 | WP_001192731.1 | helix-turn-helix transcriptional regulator | - |
| FHE73_RS13265 (FHE73_13265) | - | 2558137..2558403 (+) | 267 | WP_000522182.1 | helix-turn-helix domain-containing protein | - |
| FHE73_RS31180 | - | 2558403..2558558 (+) | 156 | WP_089149653.1 | hypothetical protein | - |
| FHE73_RS13270 (FHE73_13270) | - | 2558779..2559753 (+) | 975 | WP_089149652.1 | DnaD domain protein | - |
| FHE73_RS13275 (FHE73_13275) | abrB | 2559757..2560035 (+) | 279 | WP_089149651.1 | AbrB/MazE/SpoVT family DNA-binding domain-containing protein | Regulator |
| FHE73_RS13280 (FHE73_13280) | - | 2560028..2560387 (+) | 360 | WP_001125948.1 | hypothetical protein | - |
| FHE73_RS13285 (FHE73_13285) | - | 2560406..2560573 (+) | 168 | WP_000754942.1 | DUF3954 domain-containing protein | - |
| FHE73_RS13290 (FHE73_13290) | - | 2560599..2560850 (+) | 252 | WP_000109497.1 | hypothetical protein | - |
| FHE73_RS13295 (FHE73_13295) | - | 2560871..2561353 (+) | 483 | WP_046946251.1 | nucleoside triphosphate pyrophosphohydrolase family protein | - |
| FHE73_RS13300 (FHE73_13300) | - | 2561393..2561656 (+) | 264 | WP_000267631.1 | hypothetical protein | - |
| FHE73_RS13305 (FHE73_13305) | - | 2563672..2564982 (+) | 1311 | WP_089149650.1 | exosporium glycoprotein BclB-related protein | - |
| FHE73_RS13310 (FHE73_13310) | - | 2565297..2565551 (+) | 255 | WP_089149649.1 | hypothetical protein | - |
| FHE73_RS13315 (FHE73_13315) | - | 2565733..2566197 (-) | 465 | WP_089149648.1 | hypothetical protein | - |
| FHE73_RS13320 (FHE73_13320) | - | 2566391..2567122 (-) | 732 | WP_254704108.1 | glycosyltransferase family 2 protein | - |
| FHE73_RS13325 (FHE73_13325) | - | 2567366..2567830 (-) | 465 | WP_089149646.1 | exosporium protein D | - |
| FHE73_RS13330 (FHE73_13330) | - | 2568893..2569087 (-) | 195 | WP_089149645.1 | hypothetical protein | - |
| FHE73_RS13335 (FHE73_13335) | - | 2571300..2571515 (-) | 216 | WP_001141549.1 | spore germination protein | - |
| FHE73_RS31185 | - | 2572397..2572558 (+) | 162 | WP_089149643.1 | hypothetical protein | - |
| FHE73_RS13340 (FHE73_13340) | - | 2572585..2573067 (+) | 483 | WP_089149642.1 | ArpU family phage packaging/lysis transcriptional regulator | - |
| FHE73_RS13345 (FHE73_13345) | - | 2573067..2573609 (+) | 543 | WP_089149641.1 | site-specific integrase | - |
| FHE73_RS13350 (FHE73_13350) | - | 2574244..2574906 (-) | 663 | WP_254704101.1 | type II CAAX endopeptidase family protein | - |
| FHE73_RS13355 (FHE73_13355) | - | 2575902..2576226 (+) | 325 | Protein_2543 | hypothetical protein | - |
| FHE73_RS13360 (FHE73_13360) | - | 2576399..2576620 (+) | 222 | WP_089149637.1 | hypothetical protein | - |
| FHE73_RS13365 (FHE73_13365) | - | 2576634..2576897 (+) | 264 | WP_089149636.1 | hypothetical protein | - |
| FHE73_RS13370 (FHE73_13370) | - | 2576863..2577198 (+) | 336 | WP_089149635.1 | HNH endonuclease | - |
| FHE73_RS13375 (FHE73_13375) | - | 2577322..2577633 (+) | 312 | WP_089149634.1 | P27 family phage terminase small subunit | - |
| FHE73_RS13380 (FHE73_13380) | - | 2577630..2579297 (+) | 1668 | WP_089149633.1 | terminase TerL endonuclease subunit | - |
| FHE73_RS13385 (FHE73_13385) | - | 2579309..2580469 (+) | 1161 | WP_089149632.1 | phage portal protein | - |
| FHE73_RS13390 (FHE73_13390) | - | 2580453..2581235 (+) | 783 | WP_089149631.1 | head maturation protease, ClpP-related | - |
| FHE73_RS13395 (FHE73_13395) | - | 2581239..2582393 (+) | 1155 | WP_089149630.1 | phage major capsid protein | - |
| FHE73_RS13400 (FHE73_13400) | - | 2582399..2582692 (+) | 294 | WP_000381900.1 | hypothetical protein | - |
| FHE73_RS13405 (FHE73_13405) | - | 2582694..2583047 (+) | 354 | WP_002024166.1 | phage head closure protein | - |
| FHE73_RS13410 (FHE73_13410) | - | 2583049..2583393 (+) | 345 | WP_089149629.1 | HK97 gp10 family phage protein | - |
| FHE73_RS13415 (FHE73_13415) | - | 2583390..2583719 (+) | 330 | WP_089149628.1 | hypothetical protein | - |
| FHE73_RS13420 (FHE73_13420) | - | 2583720..2584307 (+) | 588 | WP_001004911.1 | major tail protein | - |
| FHE73_RS13425 (FHE73_13425) | - | 2584312..2584674 (+) | 363 | WP_000415911.1 | hypothetical protein | - |
| FHE73_RS13430 (FHE73_13430) | - | 2584905..2586116 (+) | 1212 | Protein_2558 | hypothetical protein | - |
| FHE73_RS13435 (FHE73_13435) | - | 2586374..2586631 (+) | 258 | WP_089149806.1 | hypothetical protein | - |
| FHE73_RS13440 (FHE73_13440) | - | 2586854..2589019 (+) | 2166 | WP_089148844.1 | phage tail tape measure protein | - |
| FHE73_RS13445 (FHE73_13445) | - | 2589061..2590518 (+) | 1458 | WP_089148843.1 | distal tail protein Dit | - |
| FHE73_RS13450 (FHE73_13450) | - | 2590515..2594819 (+) | 4305 | WP_089148842.1 | phage tail spike protein | - |
| FHE73_RS13455 (FHE73_13455) | - | 2594831..2595211 (+) | 381 | WP_089148841.1 | hypothetical protein | - |
| FHE73_RS13460 (FHE73_13460) | - | 2595246..2595671 (+) | 426 | WP_089148840.1 | phage holin family protein | - |
| FHE73_RS13465 (FHE73_13465) | - | 2595671..2596489 (+) | 819 | WP_089148839.1 | GH25 family lysozyme | - |
Sequence
Protein
Download Length: 92 a.a. Molecular weight: 10169.84 Da Isoelectric Point: 7.2802
>NTDB_id=367133 FHE73_RS13275 WP_089149651.1 2559757..2560035(+) (abrB) [Bacillus thuringiensis strain HM-311]
MKNTGVARKVDELGRVVIRIELRRTLGIAEGTALDFHIDGENIVLRKHEKSCFVTGEISETNIELLGGRMFLSKEGVIEL
LNLIQKSGLAHA
MKNTGVARKVDELGRVVIRIELRRTLGIAEGTALDFHIDGENIVLRKHEKSCFVTGEISETNIELLGGRMFLSKEGVIEL
LNLIQKSGLAHA
Nucleotide
Download Length: 279 bp
>NTDB_id=367133 FHE73_RS13275 WP_089149651.1 2559757..2560035(+) (abrB) [Bacillus thuringiensis strain HM-311]
ATGAAAAACACAGGTGTTGCAAGAAAAGTCGATGAGCTAGGTCGCGTAGTAATTCGGATAGAGTTACGCAGAACTTTAGG
GATTGCCGAAGGAACGGCACTAGATTTTCATATCGATGGTGAAAACATTGTTTTAAGAAAACATGAAAAGTCATGCTTTG
TAACCGGTGAAATTTCTGAAACCAACATAGAGTTGCTAGGTGGCCGAATGTTTTTGAGTAAGGAAGGGGTAATTGAATTA
CTGAATCTTATTCAGAAGAGTGGGCTGGCACATGCCTAA
ATGAAAAACACAGGTGTTGCAAGAAAAGTCGATGAGCTAGGTCGCGTAGTAATTCGGATAGAGTTACGCAGAACTTTAGG
GATTGCCGAAGGAACGGCACTAGATTTTCATATCGATGGTGAAAACATTGTTTTAAGAAAACATGAAAAGTCATGCTTTG
TAACCGGTGAAATTTCTGAAACCAACATAGAGTTGCTAGGTGGCCGAATGTTTTTGAGTAAGGAAGGGGTAATTGAATTA
CTGAATCTTATTCAGAAGAGTGGGCTGGCACATGCCTAA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| abrB | Bacillus subtilis subsp. subtilis str. 168 |
57.471 |
94.565 |
0.543 |