Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   FC605_RS02155 Genome accession   NZ_CP040528
Coordinates   422222..422344 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PR10     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 417222..427344
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  FC605_RS02140 (FC605_02140) yclJ 418836..419519 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  FC605_RS02145 (FC605_02145) yclK 419506..420927 (+) 1422 WP_080528922.1 two-component system sensor histidine kinase YclK -
  FC605_RS02150 (FC605_02150) rapC 421090..422238 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  FC605_RS02155 (FC605_02155) phrC 422222..422344 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  FC605_RS02160 (FC605_02160) yczM 422444..422533 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  FC605_RS02165 (FC605_02165) yczN 422615..422728 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  FC605_RS02170 (FC605_02170) thrD 422882..424246 (-) 1365 WP_003234493.1 aspartate kinase -
  FC605_RS02175 (FC605_02175) ceuB 424631..425581 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  FC605_RS02180 (FC605_02180) yclO 425574..426521 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  FC605_RS02185 (FC605_02185) yclP 426515..427273 (+) 759 WP_046664285.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=364987 FC605_RS02155 WP_003224994.1 422222..422344(+) (phrC) [Bacillus subtilis strain PR10]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=364987 FC605_RS02155 WP_003224994.1 422222..422344(+) (phrC) [Bacillus subtilis strain PR10]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment