Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   FCJ76_RS02205 Genome accession   NZ_CP039935
Coordinates   430202..430324 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain H19     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 425202..435324
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  FCJ76_RS02190 yclJ 426815..427498 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  FCJ76_RS02195 yclK 427485..428906 (+) 1422 WP_086343454.1 two-component system sensor histidine kinase YclK -
  FCJ76_RS02200 rapC 429070..430218 (+) 1149 WP_086343455.1 response regulator aspartate phosphatase RapC Regulator
  FCJ76_RS02205 phrC 430202..430324 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  FCJ76_RS02210 yczM 430422..430511 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  FCJ76_RS02215 yczN 430593..430706 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  FCJ76_RS02220 thrD 430859..432223 (-) 1365 WP_086343456.1 aspartate kinase -
  FCJ76_RS02225 ceuB 432608..433558 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  FCJ76_RS02230 yclO 433551..434498 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  FCJ76_RS02235 yclP 434492..435250 (+) 759 WP_086343457.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=361101 FCJ76_RS02205 WP_003224994.1 430202..430324(+) (phrC) [Bacillus subtilis strain H19]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=361101 FCJ76_RS02205 WP_003224994.1 430202..430324(+) (phrC) [Bacillus subtilis strain H19]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment