Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   GII83_RS02160 Genome accession   NZ_CP045818
Coordinates   428280..428402 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain MB9_B6     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 423280..433402
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GII83_RS02145 (GII83_02145) yclJ 424894..425577 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  GII83_RS02150 (GII83_02150) yclK 425564..426985 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  GII83_RS02155 (GII83_02155) rapC 427148..428296 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  GII83_RS02160 (GII83_02160) phrC 428280..428402 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GII83_RS02165 (GII83_02165) yczM 428502..428591 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  GII83_RS02170 (GII83_02170) yczN 428673..428786 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  GII83_RS02175 (GII83_02175) thrD 428939..430303 (-) 1365 WP_029726569.1 aspartate kinase -
  GII83_RS02180 (GII83_02180) ceuB 430688..431638 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  GII83_RS02185 (GII83_02185) yclO 431631..432578 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  GII83_RS02190 (GII83_02190) yclP 432572..433330 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=346898 GII83_RS02160 WP_003224994.1 428280..428402(+) (phrC) [Bacillus subtilis strain MB9_B6]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=346898 GII83_RS02160 WP_003224994.1 428280..428402(+) (phrC) [Bacillus subtilis strain MB9_B6]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1