Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   GII85_RS02125 Genome accession   NZ_CP045817
Coordinates   421494..421616 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain P5_B1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416494..426616
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GII85_RS02110 (GII85_02110) yclJ 418107..418790 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  GII85_RS02115 (GII85_02115) yclK 418777..420198 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  GII85_RS02120 (GII85_02120) rapC 420362..421510 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  GII85_RS02125 (GII85_02125) phrC 421494..421616 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GII85_RS02130 (GII85_02130) yczM 421716..421805 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  GII85_RS02135 (GII85_02135) yczN 421887..422000 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  GII85_RS02140 (GII85_02140) thrD 422153..423517 (-) 1365 WP_041850695.1 aspartate kinase -
  GII85_RS02145 (GII85_02145) ceuB 423902..424852 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  GII85_RS02150 (GII85_02150) yclO 424845..425792 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  GII85_RS02155 (GII85_02155) yclP 425786..426544 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=346747 GII85_RS02125 WP_003224994.1 421494..421616(+) (phrC) [Bacillus subtilis strain P5_B1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=346747 GII85_RS02125 WP_003224994.1 421494..421616(+) (phrC) [Bacillus subtilis strain P5_B1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1