Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ETL58_RS02240 Genome accession   NZ_CP035413
Coordinates   431935..432057 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103629     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 426935..437057
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ETL58_RS02225 (ETL58_02225) yclJ 428548..429231 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ETL58_RS02230 (ETL58_02230) yclK 429218..430639 (+) 1422 WP_101172129.1 two-component system sensor histidine kinase YclK -
  ETL58_RS02235 (ETL58_02235) rapC 430803..431951 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ETL58_RS02240 (ETL58_02240) phrC 431935..432057 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ETL58_RS02245 (ETL58_02245) yczM 432157..432246 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ETL58_RS02250 (ETL58_02250) yczN 432328..432441 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ETL58_RS02255 (ETL58_02255) thrD 432595..433959 (-) 1365 WP_038428355.1 aspartate kinase -
  ETL58_RS02260 (ETL58_02260) ceuB 434344..435294 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ETL58_RS02265 (ETL58_02265) yclO 435287..436234 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ETL58_RS02270 (ETL58_02270) yclP 436228..436986 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=340766 ETL58_RS02240 WP_003224994.1 431935..432057(+) (phrC) [Bacillus subtilis strain SRCM103629]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=340766 ETL58_RS02240 WP_003224994.1 431935..432057(+) (phrC) [Bacillus subtilis strain SRCM103629]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment