Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ETK71_RS02115 Genome accession   NZ_CP035411
Coordinates   416264..416386 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103622     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 411264..421386
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ETK71_RS02100 (ETK71_02100) yclJ 412878..413561 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ETK71_RS02105 (ETK71_02105) yclK 413548..414969 (+) 1422 WP_113713032.1 two-component system sensor histidine kinase YclK -
  ETK71_RS02110 (ETK71_02110) rapC 415132..416280 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  ETK71_RS02115 (ETK71_02115) phrC 416264..416386 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ETK71_RS02120 (ETK71_02120) yczM 416488..416577 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ETK71_RS02125 (ETK71_02125) yczN 416659..416772 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ETK71_RS02130 (ETK71_02130) thrD 416926..418290 (-) 1365 WP_043940054.1 aspartate kinase -
  ETK71_RS02135 (ETK71_02135) ceuB 418675..419625 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ETK71_RS02140 (ETK71_02140) yclO 419618..420565 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ETK71_RS02145 (ETK71_02145) yclP 420559..421317 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=340686 ETK71_RS02115 WP_003224994.1 416264..416386(+) (phrC) [Bacillus subtilis strain SRCM103622]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=340686 ETK71_RS02115 WP_003224994.1 416264..416386(+) (phrC) [Bacillus subtilis strain SRCM103622]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment