Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ETK61_RS02190 Genome accession   NZ_CP035406
Coordinates   431107..431229 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103612     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 426107..436229
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ETK61_RS02175 (ETK61_02175) yclJ 427720..428403 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ETK61_RS02180 (ETK61_02180) yclK 428390..429811 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  ETK61_RS02185 (ETK61_02185) rapC 429975..431123 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  ETK61_RS02190 (ETK61_02190) phrC 431107..431229 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ETK61_RS02195 (ETK61_02195) yczM 431329..431418 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ETK61_RS02200 (ETK61_02200) yczN 431500..431613 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  ETK61_RS02205 (ETK61_02205) thrD 431766..433130 (-) 1365 WP_033883679.1 aspartate kinase -
  ETK61_RS02210 (ETK61_02210) ceuB 433515..434465 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ETK61_RS02215 (ETK61_02215) yclO 434458..435405 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ETK61_RS02220 (ETK61_02220) yclP 435399..436157 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=340530 ETK61_RS02190 WP_003224994.1 431107..431229(+) (phrC) [Bacillus subtilis strain SRCM103612]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=340530 ETK61_RS02190 WP_003224994.1 431107..431229(+) (phrC) [Bacillus subtilis strain SRCM103612]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment