Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ETA15_RS02335 Genome accession   NZ_CP035403
Coordinates   468821..468943 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103581     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 463821..473943
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ETA15_RS02320 (ETA15_02320) yclJ 465434..466117 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ETA15_RS02325 (ETA15_02325) yclK 466104..467525 (+) 1422 WP_080317125.1 two-component system sensor histidine kinase YclK -
  ETA15_RS02330 (ETA15_02330) rapC 467689..468837 (+) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  ETA15_RS02335 (ETA15_02335) phrC 468821..468943 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ETA15_RS02340 (ETA15_02340) yczM 469043..469132 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ETA15_RS02345 (ETA15_02345) yczN 469214..469327 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ETA15_RS02350 (ETA15_02350) thrD 469481..470845 (-) 1365 WP_041340152.1 aspartate kinase -
  ETA15_RS02355 (ETA15_02355) ceuB 471230..472180 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ETA15_RS02360 (ETA15_02360) yclO 472173..473120 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ETA15_RS02365 (ETA15_02365) yclP 473114..473872 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=340307 ETA15_RS02335 WP_003224994.1 468821..468943(+) (phrC) [Bacillus subtilis strain SRCM103581]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=340307 ETA15_RS02335 WP_003224994.1 468821..468943(+) (phrC) [Bacillus subtilis strain SRCM103581]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment