Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ETA19_RS02210 Genome accession   NZ_CP035401
Coordinates   432602..432724 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103837     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 427602..437724
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ETA19_RS02195 (ETA19_02195) yclJ 429215..429898 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ETA19_RS02200 (ETA19_02200) yclK 429885..431306 (+) 1422 WP_113713032.1 two-component system sensor histidine kinase YclK -
  ETA19_RS02205 (ETA19_02205) rapC 431470..432618 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ETA19_RS02210 (ETA19_02210) phrC 432602..432724 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ETA19_RS02215 (ETA19_02215) yczM 432824..432913 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ETA19_RS02220 (ETA19_02220) yczN 432995..433108 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ETA19_RS02225 (ETA19_02225) thrD 433262..434626 (-) 1365 WP_128992406.1 aspartate kinase -
  ETA19_RS02230 (ETA19_02230) ceuB 435011..435961 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ETA19_RS02235 (ETA19_02235) yclO 435954..436901 (+) 948 WP_128992407.1 petrobactin ABC transporter permease YclO -
  ETA19_RS02240 (ETA19_02240) yclP 436895..437653 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=340147 ETA19_RS02210 WP_003224994.1 432602..432724(+) (phrC) [Bacillus subtilis strain SRCM103837]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=340147 ETA19_RS02210 WP_003224994.1 432602..432724(+) (phrC) [Bacillus subtilis strain SRCM103837]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment