Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ETA18_RS02210 Genome accession   NZ_CP035400
Coordinates   432601..432723 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103835     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 427601..437723
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ETA18_RS02195 (ETA18_02195) yclJ 429214..429897 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ETA18_RS02200 (ETA18_02200) yclK 429884..431305 (+) 1422 WP_113713032.1 two-component system sensor histidine kinase YclK -
  ETA18_RS02205 (ETA18_02205) rapC 431469..432617 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ETA18_RS02210 (ETA18_02210) phrC 432601..432723 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ETA18_RS02215 (ETA18_02215) yczM 432823..432912 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ETA18_RS02220 (ETA18_02220) yczN 432994..433107 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ETA18_RS02225 (ETA18_02225) thrD 433261..434625 (-) 1365 WP_128992406.1 aspartate kinase -
  ETA18_RS02230 (ETA18_02230) ceuB 435010..435960 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ETA18_RS02235 (ETA18_02235) yclO 435953..436900 (+) 948 WP_128992407.1 petrobactin ABC transporter permease YclO -
  ETA18_RS02240 (ETA18_02240) yclP 436894..437652 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=340066 ETA18_RS02210 WP_003224994.1 432601..432723(+) (phrC) [Bacillus subtilis strain SRCM103835]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=340066 ETA18_RS02210 WP_003224994.1 432601..432723(+) (phrC) [Bacillus subtilis strain SRCM103835]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment