Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ES968_RS02170 Genome accession   NZ_CP035395
Coordinates   442399..442521 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103697     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 437399..447521
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ES968_RS02155 (ES968_02155) yclJ 439012..439695 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ES968_RS02160 (ES968_02160) yclK 439682..441103 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  ES968_RS02165 (ES968_02165) rapC 441267..442415 (+) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  ES968_RS02170 (ES968_02170) phrC 442399..442521 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ES968_RS02175 (ES968_02175) yczM 442620..442709 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ES968_RS02180 (ES968_02180) yczN 442791..442904 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  ES968_RS02185 (ES968_02185) thrD 443057..444421 (-) 1365 WP_021481755.1 aspartate kinase -
  ES968_RS02190 (ES968_02190) ceuB 444812..445762 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ES968_RS02195 (ES968_02195) yclO 445755..446702 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  ES968_RS02200 (ES968_02200) yclP 446696..447454 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=339832 ES968_RS02170 WP_003224994.1 442399..442521(+) (phrC) [Bacillus subtilis strain SRCM103697]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=339832 ES968_RS02170 WP_003224994.1 442399..442521(+) (phrC) [Bacillus subtilis strain SRCM103697]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment