Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ES967_RS02145 Genome accession   NZ_CP035394
Coordinates   423983..424105 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103696     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 418983..429105
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ES967_RS02130 (ES967_02130) yclJ 420596..421279 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ES967_RS02135 (ES967_02135) yclK 421266..422687 (+) 1422 WP_080479511.1 two-component system sensor histidine kinase YclK -
  ES967_RS02140 (ES967_02140) rapC 422851..423999 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ES967_RS02145 (ES967_02145) phrC 423983..424105 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ES967_RS02150 (ES967_02150) yczM 424205..424294 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ES967_RS02155 (ES967_02155) yczN 424376..424489 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ES967_RS02160 (ES967_02160) thrD 424643..426007 (-) 1365 WP_110109576.1 aspartate kinase -
  ES967_RS02165 (ES967_02165) ceuB 426392..427342 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ES967_RS02170 (ES967_02170) yclO 427335..428282 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  ES967_RS02175 (ES967_02175) yclP 428276..429034 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=339748 ES967_RS02145 WP_003224994.1 423983..424105(+) (phrC) [Bacillus subtilis strain SRCM103696]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=339748 ES967_RS02145 WP_003224994.1 423983..424105(+) (phrC) [Bacillus subtilis strain SRCM103696]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment