Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ES965_RS02150 Genome accession   NZ_CP035391
Coordinates   421156..421278 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103689     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 416156..426278
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ES965_RS02135 (ES965_02135) yclJ 417769..418452 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ES965_RS02140 (ES965_02140) yclK 418439..419860 (+) 1422 WP_086343454.1 two-component system sensor histidine kinase YclK -
  ES965_RS02145 (ES965_02145) rapC 420024..421172 (+) 1149 WP_077671292.1 response regulator aspartate phosphatase RapC Regulator
  ES965_RS02150 (ES965_02150) phrC 421156..421278 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ES965_RS02155 (ES965_02155) yczM 421376..421465 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ES965_RS02160 (ES965_02160) yczN 421547..421660 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  ES965_RS02165 (ES965_02165) thrD 421813..423177 (-) 1365 WP_124060086.1 aspartate kinase -
  ES965_RS02170 (ES965_02170) ceuB 423562..424512 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ES965_RS02175 (ES965_02175) yclO 424505..425452 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ES965_RS02180 (ES965_02180) yclP 425446..426204 (+) 759 WP_124060085.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=339591 ES965_RS02150 WP_003224994.1 421156..421278(+) (phrC) [Bacillus subtilis strain SRCM103689]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=339591 ES965_RS02150 WP_003224994.1 421156..421278(+) (phrC) [Bacillus subtilis strain SRCM103689]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment