Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   EQY76_RS02165 Genome accession   NZ_CP035230
Coordinates   422188..422310 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103551     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 417188..427310
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EQY76_RS02150 (EQY76_02150) yclJ 418802..419485 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  EQY76_RS02155 (EQY76_02155) yclK 419472..420893 (+) 1422 WP_080348068.1 two-component system sensor histidine kinase YclK -
  EQY76_RS02160 (EQY76_02160) rapC 421056..422204 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  EQY76_RS02165 (EQY76_02165) phrC 422188..422310 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  EQY76_RS02170 (EQY76_02170) yczM 422410..422499 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  EQY76_RS02175 (EQY76_02175) yczN 422581..422694 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  EQY76_RS02180 (EQY76_02180) thrD 422847..424211 (-) 1365 WP_029726569.1 aspartate kinase -
  EQY76_RS02185 (EQY76_02185) ceuB 424596..425546 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  EQY76_RS02190 (EQY76_02190) yclO 425539..426486 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  EQY76_RS02195 (EQY76_02195) yclP 426480..427238 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=336343 EQY76_RS02165 WP_003224994.1 422188..422310(+) (phrC) [Bacillus subtilis strain SRCM103551]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=336343 EQY76_RS02165 WP_003224994.1 422188..422310(+) (phrC) [Bacillus subtilis strain SRCM103551]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment