Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   EQW70_RS02155 Genome accession   NZ_CP035226
Coordinates   420017..420139 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103517     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 415017..425139
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EQW70_RS02140 (EQW70_02140) yclJ 416631..417314 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  EQW70_RS02145 (EQW70_02145) yclK 417301..418722 (+) 1422 WP_122895032.1 two-component system sensor histidine kinase YclK -
  EQW70_RS02150 (EQW70_02150) rapC 418885..420033 (+) 1149 WP_122895033.1 response regulator aspartate phosphatase RapC Regulator
  EQW70_RS02155 (EQW70_02155) phrC 420017..420139 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  EQW70_RS02160 (EQW70_02160) yczM 420239..420328 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  EQW70_RS02165 (EQW70_02165) yczN 420410..420523 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  EQW70_RS02170 (EQW70_02170) thrD 420676..422040 (-) 1365 WP_128740021.1 aspartate kinase -
  EQW70_RS02175 (EQW70_02175) ceuB 422425..423375 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  EQW70_RS02180 (EQW70_02180) yclO 423368..424315 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  EQW70_RS02185 (EQW70_02185) yclP 424309..425067 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=336189 EQW70_RS02155 WP_003224994.1 420017..420139(+) (phrC) [Bacillus subtilis strain SRCM103517]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=336189 EQW70_RS02155 WP_003224994.1 420017..420139(+) (phrC) [Bacillus subtilis strain SRCM103517]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment