Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   EQI56_RS02135 Genome accession   NZ_CP035165
Coordinates   421438..421560 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103881     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 416438..426560
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EQI56_RS02120 (EQI56_02120) yclJ 418051..418734 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  EQI56_RS02125 (EQI56_02125) yclK 418721..420142 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  EQI56_RS02130 (EQI56_02130) rapC 420306..421454 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  EQI56_RS02135 (EQI56_02135) phrC 421438..421560 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  EQI56_RS02140 (EQI56_02140) yczM 421662..421751 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  EQI56_RS02145 (EQI56_02145) yczN 421833..421946 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  EQI56_RS02150 (EQI56_02150) thrD 422100..423464 (-) 1365 WP_043940054.1 aspartate kinase -
  EQI56_RS02155 (EQI56_02155) ceuB 423849..424799 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  EQI56_RS02160 (EQI56_02160) yclO 424792..425739 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  EQI56_RS02165 (EQI56_02165) yclP 425733..426491 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=335247 EQI56_RS02135 WP_003224994.1 421438..421560(+) (phrC) [Bacillus subtilis strain SRCM103881]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=335247 EQI56_RS02135 WP_003224994.1 421438..421560(+) (phrC) [Bacillus subtilis strain SRCM103881]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment