Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   EQH95_RS02250 Genome accession   NZ_CP035162
Coordinates   462653..462775 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103886     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 457653..467775
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EQH95_RS02235 (EQH95_02235) yclJ 459266..459949 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  EQH95_RS02240 (EQH95_02240) yclK 459936..461357 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  EQH95_RS02245 (EQH95_02245) rapC 461521..462669 (+) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  EQH95_RS02250 (EQH95_02250) phrC 462653..462775 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  EQH95_RS02255 (EQH95_02255) yczM 462874..462963 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  EQH95_RS02260 (EQH95_02260) yczN 463045..463158 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  EQH95_RS02265 (EQH95_02265) thrD 463311..464675 (-) 1365 WP_021481755.1 aspartate kinase -
  EQH95_RS02270 (EQH95_02270) ceuB 465066..466016 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  EQH95_RS02275 (EQH95_02275) yclO 466009..466956 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  EQH95_RS02280 (EQH95_02280) yclP 466950..467708 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=335009 EQH95_RS02250 WP_003224994.1 462653..462775(+) (phrC) [Bacillus subtilis strain SRCM103886]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=335009 EQH95_RS02250 WP_003224994.1 462653..462775(+) (phrC) [Bacillus subtilis strain SRCM103886]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment