Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   DA787_RS02195 Genome accession   NZ_CP033205
Coordinates   429970..430092 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain MBI 600     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424970..435092
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  DA787_RS02180 (DA787_02175) yclJ 426584..427267 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  DA787_RS02185 (DA787_02180) yclK 427254..428675 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  DA787_RS02190 (DA787_02185) rapC 428838..429986 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  DA787_RS02195 (DA787_02190) phrC 429970..430092 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  DA787_RS02200 (DA787_02195) yczM 430192..430281 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  DA787_RS02205 (DA787_02200) yczN 430363..430476 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  DA787_RS02210 (DA787_02205) thrD 430630..431994 (-) 1365 WP_009966541.1 aspartate kinase -
  DA787_RS02215 (DA787_02210) ceuB 432379..433329 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  DA787_RS02220 (DA787_02215) yclO 433322..434269 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  DA787_RS02225 (DA787_02220) yclP 434263..435021 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=322523 DA787_RS02195 WP_003224994.1 429970..430092(+) (phrC) [Bacillus subtilis strain MBI 600]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=322523 DA787_RS02195 WP_003224994.1 429970..430092(+) (phrC) [Bacillus subtilis strain MBI 600]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment