Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   D9C22_RS02135 Genome accession   NZ_CP033064
Coordinates   421436..421558 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. WR11     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416436..426558
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D9C22_RS02120 (D9C22_02120) yclJ 418049..418732 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D9C22_RS02125 (D9C22_02125) yclK 418719..420140 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  D9C22_RS02130 (D9C22_02130) rapC 420304..421452 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  D9C22_RS02135 (D9C22_02135) phrC 421436..421558 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D9C22_RS02140 (D9C22_02140) - 421660..421749 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D9C22_RS02145 (D9C22_02145) - 421831..421944 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  D9C22_RS02150 (D9C22_02150) - 422098..423462 (-) 1365 WP_043940054.1 aspartate kinase -
  D9C22_RS02155 (D9C22_02155) ceuB 423847..424797 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  D9C22_RS02160 (D9C22_02160) yclO 424790..425737 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  D9C22_RS02165 (D9C22_02165) yclP 425731..426489 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=321038 D9C22_RS02135 WP_003224994.1 421436..421558(+) (phrC) [Bacillus sp. WR11]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=321038 D9C22_RS02135 WP_003224994.1 421436..421558(+) (phrC) [Bacillus sp. WR11]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment