Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   D9C18_RS07970 Genome accession   NZ_CP032865
Coordinates   1475842..1475964 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain N3-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 1470842..1480964
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D9C18_RS07940 (D9C18_07940) yclP 1470909..1471667 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  D9C18_RS07945 (D9C18_07945) yclO 1471661..1472608 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  D9C18_RS07950 (D9C18_07950) ceuB 1472601..1473551 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  D9C18_RS07955 (D9C18_07955) thrD 1473942..1475306 (+) 1365 WP_014478832.1 aspartate kinase -
  D9C18_RS07960 (D9C18_07960) yczN 1475459..1475572 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  D9C18_RS07965 (D9C18_07965) yczM 1475654..1475743 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  D9C18_RS07970 (D9C18_07970) phrC 1475842..1475964 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D9C18_RS07975 (D9C18_07975) rapC 1475948..1477096 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  D9C18_RS07980 (D9C18_07980) yclK 1477259..1478680 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  D9C18_RS07985 (D9C18_07985) yclJ 1478667..1479350 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=319712 D9C18_RS07970 WP_003224994.1 1475842..1475964(-) (phrC) [Bacillus subtilis subsp. subtilis strain N3-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=319712 D9C18_RS07970 WP_003224994.1 1475842..1475964(-) (phrC) [Bacillus subtilis subsp. subtilis strain N3-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment