Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   D9C12_RS03575 Genome accession   NZ_CP032857
Coordinates   708874..708996 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain 2RL2-3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 703874..713996
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D9C12_RS03560 (D9C12_03560) yclJ 705487..706170 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D9C12_RS03565 (D9C12_03565) yclK 706157..707578 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  D9C12_RS03570 (D9C12_03570) rapC 707742..708890 (+) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  D9C12_RS03575 (D9C12_03575) phrC 708874..708996 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D9C12_RS03580 (D9C12_03580) yczM 709095..709184 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D9C12_RS03585 (D9C12_03585) yczN 709266..709379 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  D9C12_RS03590 (D9C12_03590) thrD 709532..710896 (-) 1365 WP_021481755.1 aspartate kinase -
  D9C12_RS03595 (D9C12_03595) ceuB 711287..712237 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  D9C12_RS03600 (D9C12_03600) yclO 712230..713177 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  D9C12_RS03605 (D9C12_03605) yclP 713171..713929 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=319385 D9C12_RS03575 WP_003224994.1 708874..708996(+) (phrC) [Bacillus subtilis subsp. subtilis strain 2RL2-3]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=319385 D9C12_RS03575 WP_003224994.1 708874..708996(+) (phrC) [Bacillus subtilis subsp. subtilis strain 2RL2-3]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment