Detailed information NTG0316733

Bioinformatically predicted

Overview

• Name: comGE
• Type: Machinery gene
• Locus tag: D6869_RS11935
• Genome accession: NZ_CP032526
• Coordinates: 2345091..2345387 (-)
• Length: 98 a.a.
• NCBI ID: WP_014735175.1
• Uniprot ID: -
• Organism: Lactococcus cremoris strain 4B0
• Function: dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
ICE	2339816..2353781	2345091..2345387	within	0

Gene organization within MGE regions

Location: 2339816..2353781

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
D6869_RS11900 (D6869_12055)	-	2339816..2341211 (-)	1396	Protein_2334	IS3 family transposase	-
D6869_RS11905 (D6869_12060)	-	2341284..2342093 (-)	810	WP_011836038.1	metal ABC transporter permease	-
D6869_RS11910 (D6869_12065)	-	2342086..2342823 (-)	738	WP_011836039.1	metal ABC transporter ATP-binding protein	-
D6869_RS11915 (D6869_12070)	-	2343002..2343844 (-)	843	WP_011836040.1	zinc ABC transporter substrate-binding protein	-
D6869_RS11920 (D6869_12075)	-	2343841..2344278 (-)	438	WP_011836041.1	zinc-dependent MarR family transcriptional regulator	-
D6869_RS11925 (D6869_12080)	comGG	2344359..2344658 (-)	300	WP_011836042.1	competence type IV pilus minor pilin ComGG	Machinery gene
D6869_RS11930 (D6869_12085)	comGF	2344682..2345128 (-)	447	WP_011836043.1	competence type IV pilus minor pilin ComGF	Machinery gene
D6869_RS11935 (D6869_12090)	comGE	2345091..2345387 (-)	297	WP_014735175.1	competence type IV pilus minor pilin ComGE	Machinery gene
D6869_RS11940 (D6869_12095)	comGD	2345359..2345802 (-)	444	WP_011836045.1	competence type IV pilus minor pilin ComGD	Machinery gene
D6869_RS11945 (D6869_12100)	comGC	2345750..2346100 (-)	351	WP_042211582.1	competence type IV pilus major pilin ComGC	Machinery gene
D6869_RS11950 (D6869_12105)	comGB	2346145..2347170 (-)	1026	WP_042211510.1	competence type IV pilus assembly protein ComGB	Machinery gene
D6869_RS11955 (D6869_12110)	comGA	2347070..2348050 (-)	981	WP_011836048.1	competence type IV pilus ATPase ComGA	Machinery gene
D6869_RS11960 (D6869_12115)	-	2348164..2351958 (-)	3795	Protein_2346	PolC-type DNA polymerase III	-
D6869_RS13225	-	2352478..2353071 (-)	594	Protein_2347	PolC-type DNA polymerase III N-terminal domain-containing protein	-
D6869_RS11965 (D6869_12120)	-	2353245..2353781 (-)	537	WP_011836050.1	hypothetical protein	-

Sequence

Protein

• Length: 98 a.a.
• Molecular weight: 10976.61 Da
• Isoelectric Point: 5.0659

>NTDB_id=316733 D6869_RS11935 WP_014735175.1 2345091..2345387(-) (comGE) [Lactococcus cremoris strain 4B0]
MENIKRKSIKGYILLESLISMALLSFLVTFLLSSLTNSRQQEAQENQQIESLNVAQMAIESQLTELSLNGSVIKIRQDST
ATIISDHGKEILRLEAQN

Nucleotide

• Length: 297 bp

>NTDB_id=316733 D6869_RS11935 WP_014735175.1 2345091..2345387(-) (comGE) [Lactococcus cremoris strain 4B0]
GTGGAAAATATAAAAAGAAAATCAATTAAGGGATATATACTTCTTGAGAGCCTAATTAGTATGGCATTATTGAGCTTTTT
AGTCACTTTTCTCTTGAGTTCTCTTACTAATTCTCGTCAGCAAGAGGCACAAGAAAATCAACAAATTGAGTCCTTAAATG
TAGCTCAGATGGCAATAGAAAGTCAGTTGACGGAACTATCGTTAAATGGTTCTGTTATAAAAATAAGACAAGATTCGACT
GCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterproScan.

• Type II secretory pathway pseudopilin (ComGE) (13-94)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
comGE	Lactococcus lactis subsp. cremoris KW2	100	100	1