Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   D0819_RS19015 Genome accession   NZ_CP031784
Coordinates   3672701..3672823 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain HMNig-2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3667701..3677823
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  D0819_RS19000 (D0819_19080) yclJ 3669315..3669998 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  D0819_RS19005 (D0819_19085) yclK 3669985..3671406 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  D0819_RS19010 (D0819_19090) rapC 3671569..3672717 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  D0819_RS19015 (D0819_19095) phrC 3672701..3672823 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  D0819_RS19020 (D0819_19100) yczM 3672923..3673012 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  D0819_RS19025 (D0819_19105) yczN 3673094..3673207 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  D0819_RS19030 (D0819_19110) thrD 3673360..3674724 (-) 1365 WP_021481755.1 aspartate kinase -
  D0819_RS19035 (D0819_19115) ceuB 3675109..3676059 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  D0819_RS19040 (D0819_19120) yclO 3676052..3676999 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  D0819_RS19045 (D0819_19125) yclP 3676993..3677751 (+) 759 WP_153257250.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=311420 D0819_RS19015 WP_003224994.1 3672701..3672823(+) (phrC) [Bacillus subtilis strain HMNig-2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=311420 D0819_RS19015 WP_003224994.1 3672701..3672823(+) (phrC) [Bacillus subtilis strain HMNig-2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment