Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   DXY22_RS05490 Genome accession   NZ_CP031693
Coordinates   1078611..1078733 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM101393     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1073611..1083733
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  DXY22_RS05475 (DXY22_01069) yclJ 1075225..1075908 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  DXY22_RS05480 (DXY22_01070) yclK 1075895..1077316 (+) 1422 WP_160245650.1 two-component system sensor histidine kinase YclK -
  DXY22_RS05485 (DXY22_01071) rapC 1077479..1078627 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  DXY22_RS05490 (DXY22_01072) phrC 1078611..1078733 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  DXY22_RS05495 (DXY22_01073) yczM 1078833..1078922 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  DXY22_RS05500 (DXY22_01074) yczN 1079004..1079117 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  DXY22_RS05505 (DXY22_01075) thrD 1079271..1080635 (-) 1365 WP_160245651.1 aspartate kinase -
  DXY22_RS05510 (DXY22_01076) ceuB 1081020..1081970 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  DXY22_RS05515 (DXY22_01077) yclO 1081963..1082910 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  DXY22_RS05520 (DXY22_01078) yclP 1082904..1083662 (+) 759 WP_160245652.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=310306 DXY22_RS05490 WP_003224994.1 1078611..1078733(+) (phrC) [Bacillus subtilis strain SRCM101393]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=310306 DXY22_RS05490 WP_003224994.1 1078611..1078733(+) (phrC) [Bacillus subtilis strain SRCM101393]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment