Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ES969_RS02185 Genome accession   NZ_CP035402
Coordinates   427594..427716 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103576     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 422594..432716
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ES969_RS02170 (ES969_02170) yclJ 424208..424891 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ES969_RS02175 (ES969_02175) yclK 424878..426299 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  ES969_RS02180 (ES969_02180) rapC 426462..427610 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  ES969_RS02185 (ES969_02185) phrC 427594..427716 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ES969_RS02190 (ES969_02190) yczM 427815..427904 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ES969_RS02195 (ES969_02195) yczN 427986..428099 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  ES969_RS02200 (ES969_02200) thrD 428252..429616 (-) 1365 WP_021481755.1 aspartate kinase -
  ES969_RS02205 (ES969_02205) ceuB 430007..430957 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ES969_RS02210 (ES969_02210) yclO 430950..431897 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  ES969_RS02215 (ES969_02215) yclP 431891..432649 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=299586 ES969_RS02185 WP_003224994.1 427594..427716(+) (phrC) [Bacillus subtilis strain SRCM103576]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=299586 ES969_RS02185 WP_003224994.1 427594..427716(+) (phrC) [Bacillus subtilis strain SRCM103576]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1