Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   DL538_RS02585 Genome accession   NZ_CP029609
Coordinates   484115..484237 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain G7     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 479115..489237
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  DL538_RS02570 (DL538_02560) yclJ 480729..481412 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  DL538_RS02575 (DL538_02565) yclK 481399..482820 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  DL538_RS02580 (DL538_02570) rapC 482983..484131 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  DL538_RS02585 (DL538_02575) phrC 484115..484237 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  DL538_RS02590 (DL538_02580) yczM 484337..484426 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  DL538_RS02595 (DL538_02585) yczN 484508..484621 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  DL538_RS02600 (DL538_02590) thrD 484774..486138 (-) 1365 WP_110109576.1 aspartate kinase -
  DL538_RS02605 (DL538_02595) ceuB 486523..487473 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  DL538_RS02610 (DL538_02600) yclO 487466..488413 (+) 948 WP_131227116.1 petrobactin ABC transporter permease YclO -
  DL538_RS02615 (DL538_02605) yclP 488407..489165 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=294097 DL538_RS02585 WP_003224994.1 484115..484237(+) (phrC) [Bacillus subtilis subsp. subtilis strain G7]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=294097 DL538_RS02585 WP_003224994.1 484115..484237(+) (phrC) [Bacillus subtilis subsp. subtilis strain G7]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment