Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   EQJ08_RS02170 Genome accession   NZ_CP035167
Coordinates   432656..432778 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM104008     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 427656..437778
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EQJ08_RS02155 (EQJ08_02155) yclJ 429269..429952 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  EQJ08_RS02160 (EQJ08_02160) yclK 429939..431360 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  EQJ08_RS02165 (EQJ08_02165) rapC 431524..432672 (+) 1149 WP_038828432.1 response regulator aspartate phosphatase RapC Regulator
  EQJ08_RS02170 (EQJ08_02170) phrC 432656..432778 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  EQJ08_RS02175 (EQJ08_02175) yczM 432878..432967 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  EQJ08_RS02180 (EQJ08_02180) yczN 433049..433162 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  EQJ08_RS02185 (EQJ08_02185) thrD 433315..434679 (-) 1365 WP_072173982.1 aspartate kinase -
  EQJ08_RS02190 (EQJ08_02190) ceuB 435064..436014 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  EQJ08_RS02195 (EQJ08_02195) yclO 436007..436954 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  EQJ08_RS02200 (EQJ08_02200) yclP 436948..437706 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=293413 EQJ08_RS02170 WP_003224994.1 432656..432778(+) (phrC) [Bacillus subtilis strain SRCM104008]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=293413 EQJ08_RS02170 WP_003224994.1 432656..432778(+) (phrC) [Bacillus subtilis strain SRCM104008]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1