Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   EQI87_RS02165 Genome accession   NZ_CP035166
Coordinates   422374..422496 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM103971     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 417374..427496
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EQI87_RS02150 (EQI87_02150) yclJ 418987..419670 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  EQI87_RS02155 (EQI87_02155) yclK 419657..421078 (+) 1422 WP_082098066.1 two-component system sensor histidine kinase YclK -
  EQI87_RS02160 (EQI87_02160) rapC 421242..422390 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  EQI87_RS02165 (EQI87_02165) phrC 422374..422496 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  EQI87_RS02170 (EQI87_02170) yczM 422596..422685 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  EQI87_RS02175 (EQI87_02175) yczN 422767..422880 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  EQI87_RS02180 (EQI87_02180) thrD 423034..424398 (-) 1365 WP_038428355.1 aspartate kinase -
  EQI87_RS02185 (EQI87_02185) ceuB 424783..425733 (+) 951 WP_038428356.1 petrobactin ABC transporter permease YclN Machinery gene
  EQI87_RS02190 (EQI87_02190) yclO 425726..426673 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  EQI87_RS02195 (EQI87_02195) yclP 426667..427425 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=293260 EQI87_RS02165 WP_003224994.1 422374..422496(+) (phrC) [Bacillus subtilis strain SRCM103971]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=293260 EQI87_RS02165 WP_003224994.1 422374..422496(+) (phrC) [Bacillus subtilis strain SRCM103971]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment