Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C7M30_RS08530 Genome accession   NZ_CP028218
Coordinates   1644547..1644669 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM102756     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1639547..1649669
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C7M30_RS08500 (C7M30_01702) yclP 1639618..1640376 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  C7M30_RS08505 (C7M30_01703) yclO 1640370..1641317 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  C7M30_RS08510 (C7M30_01704) ceuB 1641310..1642260 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C7M30_RS08515 (C7M30_01705) thrD 1642645..1644009 (+) 1365 WP_003234493.1 aspartate kinase -
  C7M30_RS08520 (C7M30_01706) yczN 1644163..1644276 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  C7M30_RS08525 (C7M30_01707) yczM 1644358..1644447 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  C7M30_RS08530 (C7M30_01708) phrC 1644547..1644669 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C7M30_RS08535 (C7M30_01709) rapC 1644653..1645801 (-) 1149 WP_160244266.1 response regulator aspartate phosphatase RapC Regulator
  C7M30_RS08540 (C7M30_01710) yclK 1645964..1647385 (-) 1422 WP_160244267.1 two-component system sensor histidine kinase YclK -
  C7M30_RS08545 (C7M30_01711) yclJ 1647372..1648055 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=283416 C7M30_RS08530 WP_003224994.1 1644547..1644669(-) (phrC) [Bacillus subtilis strain SRCM102756]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=283416 C7M30_RS08530 WP_003224994.1 1644547..1644669(-) (phrC) [Bacillus subtilis strain SRCM102756]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment