Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C7M29_RS02710 Genome accession   NZ_CP028217
Coordinates   515978..516100 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM102751     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 510978..521100
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C7M29_RS02680 (C7M29_00534) yclP 511050..511808 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  C7M29_RS02685 (C7M29_00535) yclO 511802..512749 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  C7M29_RS02690 (C7M29_00536) ceuB 512742..513692 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C7M29_RS02695 (C7M29_00537) thrD 514077..515441 (+) 1365 WP_003234493.1 aspartate kinase -
  C7M29_RS02700 (C7M29_00538) yczN 515594..515707 (+) 114 WP_032728921.1 YjcZ family sporulation protein -
  C7M29_RS02705 (C7M29_00539) yczM 515789..515878 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  C7M29_RS02710 (C7M29_00540) phrC 515978..516100 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C7M29_RS02715 (C7M29_00541) rapC 516084..517232 (-) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  C7M29_RS02720 (C7M29_00542) yclK 517395..518816 (-) 1422 WP_080265311.1 two-component system sensor histidine kinase YclK -
  C7M29_RS02725 (C7M29_00543) yclJ 518803..519486 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=283313 C7M29_RS02710 WP_003224994.1 515978..516100(-) (phrC) [Bacillus subtilis strain SRCM102751]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=283313 C7M29_RS02710 WP_003224994.1 515978..516100(-) (phrC) [Bacillus subtilis strain SRCM102751]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment