Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   C7M28_RS13960 Genome accession   NZ_CP028215
Coordinates   2686091..2686213 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM102750     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 2681091..2691213
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C7M28_RS13945 (C7M28_02745) yclJ 2682705..2683388 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  C7M28_RS13950 (C7M28_02746) yclK 2683375..2684796 (+) 1422 WP_080348068.1 two-component system sensor histidine kinase YclK -
  C7M28_RS13955 (C7M28_02747) rapC 2684959..2686107 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  C7M28_RS13960 (C7M28_02748) phrC 2686091..2686213 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C7M28_RS13965 yczM 2686313..2686402 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  C7M28_RS13970 (C7M28_02749) yczN 2686484..2686597 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  C7M28_RS13975 (C7M28_02750) thrD 2686750..2688114 (-) 1365 WP_029726569.1 aspartate kinase -
  C7M28_RS13980 (C7M28_02751) ceuB 2688499..2689449 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C7M28_RS13985 (C7M28_02752) yclO 2689442..2690389 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  C7M28_RS13990 (C7M28_02753) yclP 2690383..2691141 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=283277 C7M28_RS13960 WP_003224994.1 2686091..2686213(+) (phrC) [Bacillus subtilis strain SRCM102750]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=283277 C7M28_RS13960 WP_003224994.1 2686091..2686213(+) (phrC) [Bacillus subtilis strain SRCM102750]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment