Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C7M27_RS17045 Genome accession   NZ_CP028213
Coordinates   3268428..3268550 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM102749     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3263428..3273550
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C7M27_RS17015 (C7M27_03364) yclP 3263500..3264258 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  C7M27_RS17020 (C7M27_03365) yclO 3264252..3265199 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  C7M27_RS17025 (C7M27_03366) ceuB 3265192..3266142 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C7M27_RS17030 (C7M27_03367) thrD 3266527..3267891 (+) 1365 WP_128740021.1 aspartate kinase -
  C7M27_RS17035 (C7M27_03368) yczN 3268044..3268157 (+) 114 WP_032728921.1 YjcZ family sporulation protein -
  C7M27_RS17040 yczM 3268239..3268328 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  C7M27_RS17045 (C7M27_03369) phrC 3268428..3268550 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C7M27_RS17050 (C7M27_03370) rapC 3268534..3269682 (-) 1149 WP_122895033.1 response regulator aspartate phosphatase RapC Regulator
  C7M27_RS17055 (C7M27_03371) yclK 3269845..3271266 (-) 1422 WP_122895032.1 two-component system sensor histidine kinase YclK -
  C7M27_RS17060 (C7M27_03372) yclJ 3271253..3271936 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=283207 C7M27_RS17045 WP_003224994.1 3268428..3268550(-) (phrC) [Bacillus subtilis strain SRCM102749]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=283207 C7M27_RS17045 WP_003224994.1 3268428..3268550(-) (phrC) [Bacillus subtilis strain SRCM102749]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment