Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C7M26_RS12225 Genome accession   NZ_CP028212
Coordinates   2301411..2301533 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM102748     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2296411..2306533
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C7M26_RS12195 (C7M26_02403) yclP 2296483..2297241 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  C7M26_RS12200 (C7M26_02404) yclO 2297235..2298182 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  C7M26_RS12205 (C7M26_02405) ceuB 2298175..2299125 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C7M26_RS12210 (C7M26_02406) thrD 2299510..2300874 (+) 1365 WP_015715246.1 aspartate kinase -
  C7M26_RS12215 (C7M26_02407) yczN 2301027..2301140 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  C7M26_RS12220 (C7M26_02408) yczM 2301222..2301311 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  C7M26_RS12225 (C7M26_02409) phrC 2301411..2301533 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C7M26_RS12230 (C7M26_02410) rapC 2301517..2302665 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  C7M26_RS12235 (C7M26_02411) yclK 2302828..2304249 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  C7M26_RS12240 (C7M26_02412) yclJ 2304236..2304919 (-) 684 WP_032722955.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=283111 C7M26_RS12225 WP_003224994.1 2301411..2301533(-) (phrC) [Bacillus subtilis strain SRCM102748]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=283111 C7M26_RS12225 WP_003224994.1 2301411..2301533(-) (phrC) [Bacillus subtilis strain SRCM102748]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment