Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C7M23_RS01300 Genome accession   NZ_CP028209
Coordinates   234699..234821 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM102745     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 229699..239821
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C7M23_RS01270 (C7M23_00253) yclP 229771..230529 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  C7M23_RS01275 (C7M23_00254) yclO 230523..231470 (-) 948 WP_131227116.1 petrobactin ABC transporter permease YclO -
  C7M23_RS01280 (C7M23_00255) ceuB 231463..232413 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C7M23_RS01285 (C7M23_00256) thrD 232798..234162 (+) 1365 WP_110109576.1 aspartate kinase -
  C7M23_RS01290 (C7M23_00257) yczN 234315..234428 (+) 114 WP_032728921.1 YjcZ family sporulation protein -
  C7M23_RS01295 (C7M23_00258) yczM 234510..234599 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  C7M23_RS01300 (C7M23_00259) phrC 234699..234821 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C7M23_RS01305 (C7M23_00260) rapC 234805..235953 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  C7M23_RS01310 (C7M23_00261) yclK 236116..237537 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  C7M23_RS01315 (C7M23_00262) yclJ 237524..238207 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=282838 C7M23_RS01300 WP_003224994.1 234699..234821(-) (phrC) [Bacillus subtilis strain SRCM102745]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=282838 C7M23_RS01300 WP_003224994.1 234699..234821(-) (phrC) [Bacillus subtilis strain SRCM102745]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment