Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C7M17_RS13590 Genome accession   NZ_CP028202
Coordinates   2577584..2577706 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM102754     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2572584..2582706
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C7M17_RS13560 (C7M17_02683) yclP 2572657..2573415 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  C7M17_RS13565 (C7M17_02684) yclO 2573409..2574356 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  C7M17_RS13570 (C7M17_02685) ceuB 2574349..2575299 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C7M17_RS13575 (C7M17_02686) thrD 2575684..2577048 (+) 1365 WP_106074063.1 aspartate kinase -
  C7M17_RS13580 (C7M17_02687) yczN 2577202..2577315 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  C7M17_RS13585 yczM 2577397..2577486 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  C7M17_RS13590 (C7M17_02688) phrC 2577584..2577706 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C7M17_RS13595 (C7M17_02689) rapC 2577690..2578838 (-) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  C7M17_RS13600 (C7M17_02690) yclK 2579001..2580422 (-) 1422 WP_106074061.1 two-component system sensor histidine kinase YclK -
  C7M17_RS13605 (C7M17_02691) yclJ 2580409..2581092 (-) 684 WP_160245364.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=282427 C7M17_RS13590 WP_003224994.1 2577584..2577706(-) (phrC) [Bacillus subtilis strain SRCM102754]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=282427 C7M17_RS13590 WP_003224994.1 2577584..2577706(-) (phrC) [Bacillus subtilis strain SRCM102754]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGCATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment