Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   C7M16_RS01100 Genome accession   NZ_CP028201
Coordinates   236559..236681 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM102753     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 231559..241681
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C7M16_RS01085 (C7M16_00213) yclJ 233173..233856 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  C7M16_RS01090 (C7M16_00214) yclK 233843..235264 (+) 1422 WP_134818942.1 two-component system sensor histidine kinase YclK -
  C7M16_RS01095 (C7M16_00215) rapC 235427..236575 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  C7M16_RS01100 (C7M16_00216) phrC 236559..236681 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C7M16_RS01105 (C7M16_00217) yczM 236781..236870 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  C7M16_RS01110 (C7M16_00218) yczN 236952..237065 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  C7M16_RS01115 (C7M16_00219) thrD 237218..238582 (-) 1365 WP_015252822.1 aspartate kinase -
  C7M16_RS01120 (C7M16_00220) ceuB 238966..239916 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  C7M16_RS01125 (C7M16_00221) yclO 239909..240856 (+) 948 WP_131227116.1 petrobactin ABC transporter permease YclO -
  C7M16_RS01130 (C7M16_00222) yclP 240850..241608 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=282302 C7M16_RS01100 WP_003224994.1 236559..236681(+) (phrC) [Bacillus subtilis strain SRCM102753]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=282302 C7M16_RS01100 WP_003224994.1 236559..236681(+) (phrC) [Bacillus subtilis strain SRCM102753]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment